View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18033_low_32 (Length: 247)
Name: NF18033_low_32
Description: NF18033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18033_low_32 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 102 - 247
Target Start/End: Complemental strand, 29572011 - 29571866
Alignment:
| Q |
102 |
gaactagaatttcatttggtattattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29572011 |
gaactagaatttcatttggtataattattggaacttcttcagtgaataactcattcattagttccattgttgagtcaaaaattggtgtcataatttggtc |
29571912 |
T |
 |
| Q |
202 |
ttgttctttagcttcagttattgttgatgactcaaatgatgtttct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29571911 |
ttgttctttagcttcagttattgttgatgactcaaatgatgtttct |
29571866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 43
Target Start/End: Complemental strand, 29572100 - 29572070
Alignment:
| Q |
13 |
atcagggagaagcaagtcttcaaggaagtta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29572100 |
atcagggagaagcaagtcttcaaggaagtta |
29572070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University