View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18033_low_35 (Length: 237)
Name: NF18033_low_35
Description: NF18033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18033_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 25944612 - 25944832
Alignment:
| Q |
1 |
catgcaaatacgtaacagcttcacctgctattctaatatttctactagttttgaattaaataaactaaaatcatcattaaaatacacaacaagagaactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25944612 |
catgcaaatacgtaacagcttcacctgctattctaatatttctactacttttgaattaaataaactaaaatcatcattaaaatacacaacaagagaactt |
25944711 |
T |
|
| Q |
101 |
gggagttaggaccgctgtcttgtcttgactgtatcttctaatggctttccatgccaacttttgccgtcttcccaccactcgcatcgacgttccttctccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25944712 |
aggagttaggaccgctgtcttgtcttgactgtatcttctaatggctttccatgccaacttttgccgttttcccaccactcgcatcgacgttccttctccg |
25944811 |
T |
|
| Q |
201 |
gatagaatccggtgcaggaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25944812 |
gatagaatccggtgcaggaaa |
25944832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University