View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18033_low_41 (Length: 205)

Name: NF18033_low_41
Description: NF18033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18033_low_41
NF18033_low_41
[»] chr4 (1 HSPs)
chr4 (13-151)||(42607567-42607705)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 151
Target Start/End: Original strand, 42607567 - 42607705
Alignment:
13 attattctcagtgataattgatgtttataacacgacttttgctagttacatgtctaattttctggttatacttttcaaaataactaaccgttatgaagtg 112  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  |||| |||||||||||    
42607567 attattcccagtgataattgatgtttataacacgacttttgctagttacacgtctaattttctggttatacttttcaaaatatttaactgttatgaagtg 42607666  T
113 tttgttttataattgtgaaagttattctcaataatatgt 151  Q
    |||||||||||||||| ||||||||||||||||||||||    
42607667 tttgttttataattgtaaaagttattctcaataatatgt 42607705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University