View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18034_high_15 (Length: 256)
Name: NF18034_high_15
Description: NF18034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18034_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 41 - 240
Target Start/End: Complemental strand, 31464014 - 31463816
Alignment:
| Q |
41 |
cattgtgtttggtggtagaaatgcatcatttaggatgagatgagggaggagaaacatggaagtggcaaagaaggctgtttacatgggaggaggatcttct |
140 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||| | | |||||||||| ||||||| |||||| |||||||||| |||| | |
|
|
| T |
31464014 |
cattgtgttcggtggtagaaatgcatcatttaggatgggatgagggaggacaggcgtggaagtggcgaagaaggttgtttatgtgggaggagggtcttat |
31463915 |
T |
 |
| Q |
141 |
taagaactattgnnnnnnngttaaataacactattttgcaggatgatatactcatgactgttggatattgttactcgatccaatcaaatgcttctctgtc |
240 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31463914 |
taagaactgatgtttttt-gttaaataacactgttttgcaggatgatatactcatgactgttggatattgttactcgatccaatcaaatgcttctctgtc |
31463816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 148
Target Start/End: Complemental strand, 10746157 - 10746070
Alignment:
| Q |
61 |
atgcatcatttaggatgagatgagggaggagaaacatggaagtggcaaagaaggctgtttacatgggaggaggatcttcttaagaact |
148 |
Q |
| |
|
|||||| ||||||| || |||||||||||||| | |||||||||| |||||| ||||| ||||||||| ||| ||||||| ||||| |
|
|
| T |
10746157 |
atgcattatttagggtgggatgagggaggagaggcgtggaagtggcgtagaaggttgtttgcatgggaggcggaccttcttaggaact |
10746070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University