View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18034_high_18 (Length: 205)
Name: NF18034_high_18
Description: NF18034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18034_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 31476194 - 31476011
Alignment:
| Q |
11 |
gtgagatgaaaaaaggcacaagatttataaaatgagttcgaagcttttggtg--------gcttgttcttcgtgtattggtaaacataattttcattagt |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31476194 |
gtgaaatgaaaaaaggcacaagatttataaaatgagttcgaggcttttggtgtatacatggattgttcttcttgtattggtaaacataattttcattagt |
31476095 |
T |
 |
| Q |
103 |
catcacctagtattgcttcgtcttcatgccacattaccctcttggttgcatatataaaattagttttgaatattagtttgtctc |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31476094 |
catcacctagtattgcttcctcttcatgccacattaccctcttggttgcatatataaaattagttttgaatattagtttgtctc |
31476011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 141
Target Start/End: Complemental strand, 31501499 - 31501439
Alignment:
| Q |
80 |
tggtaaacataattttcattagtcatcacctagtattgcttcgtcttcatgccacattaccc |
141 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
31501499 |
tggtaaacaaaattttcattagtcatcacctagt-ttgcattctcttcatgccacattaccc |
31501439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 166
Target Start/End: Complemental strand, 31465824 - 31465752
Alignment:
| Q |
93 |
tttcattagtcatcacctagtattgcttcgtcttcatgccacattaccctcttggttgcatatataaaattagt |
166 |
Q |
| |
|
|||||||||||| ||||||| |||| || |||||||||||||||||||| || || || ||||||||||||| |
|
|
| T |
31465824 |
tttcattagtcaccacctagc-ttgcctcctcttcatgccacattaccctattcatttcaaatataaaattagt |
31465752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University