View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18034_high_5 (Length: 382)
Name: NF18034_high_5
Description: NF18034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18034_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 47 - 382
Target Start/End: Original strand, 40470881 - 40471222
Alignment:
| Q |
47 |
ctggttcaactctattttaatctgcttcaaccagactatagcataactggaatgaaaccaaccaacgaactggctggttcacagttgaagctgtcttttt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470881 |
ctggttcaactctattttaatctgcttcaacctgactatagtataaccggaatgaaaccaaccaacgaactggctggttcacagttgaagctgtcttttt |
40470980 |
T |
 |
| Q |
147 |
gatccagtttttaataaaacattgcaaataatatgaagttatatattgcaaactcatgaagctattatgtataaacttcaggctatagatttagt----- |
241 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40470981 |
gatccagtttt---taaaacattgcaaattatatgaagttatatattgcaaactcatgaagctattatgtataaacttcaggctatagatttagtaaaaa |
40471077 |
T |
 |
| Q |
242 |
----nnnnnnnnnnnnntcaccttcttttacttctagagtcatcttcctctgcctcaaatcctttgcttccttcctcacattccccgcttagaccacaag |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40471078 |
aaaaagaaagaaaaaaatcaccttcttttacttctagagtcatcttcctctgcctcaaatcctttgcttccttcctcacattccccacttagaccacaag |
40471177 |
T |
 |
| Q |
338 |
aagtttctagagcagaatcattaggctgtgaagctttgacttgat |
382 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40471178 |
aagtttctagagcagaatcatcaggcagtgaagctttgacttgat |
40471222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University