View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18034_high_7 (Length: 330)
Name: NF18034_high_7
Description: NF18034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18034_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 17 - 316
Target Start/End: Complemental strand, 54473408 - 54473109
Alignment:
| Q |
17 |
atgatgtacgcggctgatagtatcaacctcagcttgaaattctctgtcaccttgtccaccagttgatttaaggctctttaccgctatttccttaccatta |
116 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54473408 |
atgatgtacacggcttatagtatcaacctcagcttgaaattctctgtcaccttgtccaccagttgatttaaggctcttcaccgctatttccttaccatta |
54473309 |
T |
 |
| Q |
117 |
gggagaatacctttatgtacatatccaaacccaccttgacccaacaagttttgttttgaaaacccaccggtggcagttgataactcttcataactgaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473308 |
gggagaatacctttatgtacatatccaaacccaccttgacccaacaagttttgttttgaaaacccaccggtggcagttgataactcttcataactgaatg |
54473209 |
T |
 |
| Q |
217 |
agctctggttgaacccaagtgcaaccgttgggtgtggtggtggcaatacaggatctactgggccagagtaactggagttggtcaactcactgctactaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473208 |
agctctggttgaacccaagtgcaaccgttgggtgtggtggtggcaatacaggatctactgggccagagtaactggagttggtcaactcactgctactaac |
54473109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 32902757 - 32902708
Alignment:
| Q |
108 |
ttaccattagggagaatacctttatgtacatatccaaacccaccttgacc |
157 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
32902757 |
ttaccattagggagaatacctctatgcacatatccaaatccaccttgacc |
32902708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University