View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18035_high_14 (Length: 306)

Name: NF18035_high_14
Description: NF18035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18035_high_14
NF18035_high_14
[»] chr4 (1 HSPs)
chr4 (1-295)||(32666736-32667030)
[»] chr1 (2 HSPs)
chr1 (18-126)||(33109294-33109402)
chr1 (18-126)||(33115329-33115437)
[»] chr3 (1 HSPs)
chr3 (18-136)||(37315765-37315883)


Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 32667030 - 32666736
Alignment:
1 tagattcttcttagggcttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32667030 tagattcttcttagggcttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagct 32666931  T
101 gcggttttttctatgcaagggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666930 gcggttttttctatgcaagggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggctt 32666831  T
201 ttgatgtgccgccggaggctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcgtatgatgatg 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32666830 ttgatgtgccgccggaggctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcgtatgatgatg 32666736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 33109294 - 33109402
Alignment:
18 ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca 117  Q
    ||||||||||||||||||| ||| | ||| |||| ||||||||||||| ||| || || | |||  ||||  ||||||| ||||| || ||| |||||||    
33109294 ttggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaagaagacgcgaggagcttttatcgctgcagtgtttgctatgca 33109393  T
118 agggtttgg 126  Q
    ||| |||||    
33109394 aggatttgg 33109402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 33115329 - 33115437
Alignment:
18 ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca 117  Q
    |||||||||| |||||||| ||| | ||  |||| || |||||||||| ||||||||||| |||  | ||| | |||||||| || |||||  |||||||    
33115329 ttggaattggcggtgattaccctctttcagctactatcatgtctgagtatgcaaataaaaagactcgtggtgcatttatagcggctgttttcgctatgca 33115428  T
118 agggtttgg 126  Q
    ||| |||||    
33115429 aggttttgg 33115437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 37315883 - 37315765
Alignment:
18 ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca 117  Q
    |||| |||||||||||||| ||| | ||  |||| ||||||||||| | ||| || |||| |||  | ||  | ||||||||| |||||||| |||||||    
37315883 ttggtattggtggtgattaccctctttcagctactattatgtctgaatatgccaacaaaaagactcgtggcgcgtttatagcttcggtttttgctatgca 37315784  T
118 agggtttggtatattggct 136  Q
    ||||||||| || ||||||    
37315783 agggtttggaattttggct 37315765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University