View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18035_high_14 (Length: 306)
Name: NF18035_high_14
Description: NF18035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18035_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 32667030 - 32666736
Alignment:
| Q |
1 |
tagattcttcttagggcttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32667030 |
tagattcttcttagggcttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagct |
32666931 |
T |
 |
| Q |
101 |
gcggttttttctatgcaagggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666930 |
gcggttttttctatgcaagggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggctt |
32666831 |
T |
 |
| Q |
201 |
ttgatgtgccgccggaggctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcgtatgatgatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666830 |
ttgatgtgccgccggaggctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcgtatgatgatg |
32666736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 33109294 - 33109402
Alignment:
| Q |
18 |
ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca |
117 |
Q |
| |
|
||||||||||||||||||| ||| | ||| |||| ||||||||||||| ||| || || | ||| |||| ||||||| ||||| || ||| ||||||| |
|
|
| T |
33109294 |
ttggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaagaagacgcgaggagcttttatcgctgcagtgtttgctatgca |
33109393 |
T |
 |
| Q |
118 |
agggtttgg |
126 |
Q |
| |
|
||| ||||| |
|
|
| T |
33109394 |
aggatttgg |
33109402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 33115329 - 33115437
Alignment:
| Q |
18 |
ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca |
117 |
Q |
| |
|
|||||||||| |||||||| ||| | || |||| || |||||||||| ||||||||||| ||| | ||| | |||||||| || ||||| ||||||| |
|
|
| T |
33115329 |
ttggaattggcggtgattaccctctttcagctactatcatgtctgagtatgcaaataaaaagactcgtggtgcatttatagcggctgttttcgctatgca |
33115428 |
T |
 |
| Q |
118 |
agggtttgg |
126 |
Q |
| |
|
||| ||||| |
|
|
| T |
33115429 |
aggttttgg |
33115437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 37315883 - 37315765
Alignment:
| Q |
18 |
ttggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgca |
117 |
Q |
| |
|
|||| |||||||||||||| ||| | || |||| ||||||||||| | ||| || |||| ||| | || | ||||||||| |||||||| ||||||| |
|
|
| T |
37315883 |
ttggtattggtggtgattaccctctttcagctactattatgtctgaatatgccaacaaaaagactcgtggcgcgtttatagcttcggtttttgctatgca |
37315784 |
T |
 |
| Q |
118 |
agggtttggtatattggct |
136 |
Q |
| |
|
||||||||| || |||||| |
|
|
| T |
37315783 |
agggtttggaattttggct |
37315765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University