View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18035_low_17 (Length: 250)
Name: NF18035_low_17
Description: NF18035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18035_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 41707092 - 41707282
Alignment:
| Q |
1 |
tgctattgtatgattttggacagaactaaaagattctttgctgttttagttcatgtagtaccagtacttgtttaacctctaagtatgtttgtccttcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41707092 |
tgctattgtatgattttggacagaactaaaagattctttgctgttttagttcatgtagtactagtacttgtttaacctctaagtatgtttgtccttccac |
41707191 |
T |
|
| Q |
101 |
ttagaggtgcaatttcttttaaaattgtcaatgttgttattaaaagtgtgttgaatcacgaggggagctcggggaaccacgctagtgagag |
191 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41707192 |
tgagaggtgcaatttcttttaaaattgtcaatgttgttattaaaagtgtgttggatcatgaggggagttcggggaaccacgctagtgagag |
41707282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 41707407 - 41707456
Alignment:
| Q |
192 |
gctttctgcagcaaatgaaccggatg-cttggtcgtacccttcgtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41707407 |
gctttctgcagcaaatgaaccggatgccttggtcgtacccttcgtctctg |
41707456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 191
Target Start/End: Original strand, 41707470 - 41707506
Alignment:
| Q |
155 |
atcacgaggggagctcggggaaccacgctagtgagag |
191 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41707470 |
atcacgaggggagctcgaggaaccacgctagtgagag |
41707506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University