View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18037_high_19 (Length: 260)
Name: NF18037_high_19
Description: NF18037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18037_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 41986440 - 41986651
Alignment:
| Q |
10 |
agtgagaagaacatcagtgaaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatg |
109 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986440 |
agtgaaaagaacatcagtggaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatg |
41986539 |
T |
 |
| Q |
110 |
gtgaggaaggtgcta----tatctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctgaactg |
205 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986540 |
gtgaggaaggtgctatagctagctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctgaactg |
41986639 |
T |
 |
| Q |
206 |
aagtgtttccta |
217 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41986640 |
aagtgtttccta |
41986651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University