View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18037_high_8 (Length: 430)
Name: NF18037_high_8
Description: NF18037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18037_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 304 - 427
Target Start/End: Complemental strand, 5721101 - 5720975
Alignment:
| Q |
304 |
tttggtgctatatcgtactttgctactatagaaattgttttcattttgttaccacattataggtacgaagtttctactacaattt---agtgactaatct |
400 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
5721101 |
tttggtgctatatcatacttcgctactatagaaattgttttcattttgttaccacgttataggtacgaagcttccactacaatttagcagtgactaatct |
5721002 |
T |
 |
| Q |
401 |
ctgtcaaataatatgttgggcccatat |
427 |
Q |
| |
|
|| ||||||||| |||||||||||||| |
|
|
| T |
5721001 |
ctatcaaataatttgttgggcccatat |
5720975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University