View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18037_low_20 (Length: 259)
Name: NF18037_low_20
Description: NF18037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18037_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 5 - 245
Target Start/End: Complemental strand, 41582498 - 41582258
Alignment:
| Q |
5 |
aaaggccgtaaaccaattcgatcttcagagggatcagggggagcttatctcatgcaagattcatctggcttaaaatatgtttcaatcttcaagcctaccg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41582498 |
aaaggccgtaaaccaattcgatcttcagagggatcagggggagcttatctcatgcaagattcatctggcttaaaatatgtttcaatcttcaagcctaccg |
41582399 |
T |
 |
| Q |
105 |
atgaggagccgatggcatttaataatccccgaggattacctatctctgtggatggtgaagggttaaagaaaggcacacaagtagggcaaggtgcattgag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41582398 |
atgaggagccaatggcatttaataatccccgaggattacctatctctgtggatggtgaagggttaaagaaaggcacacaagtagggcaaggtgcattgag |
41582299 |
T |
 |
| Q |
205 |
agaagttgcagcttacattttagatcatccgaggaaaggac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41582298 |
agaagttgcagcttacattttagatcatccgaggaaaggac |
41582258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University