View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18038_low_17 (Length: 255)
Name: NF18038_low_17
Description: NF18038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18038_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32823078 - 32822844
Alignment:
| Q |
1 |
gaagtgcggcgtagattctattccagaacttgcactgctcggggacattcacaaacctcgtagcttccatcatctctcgagagtacttcttcttcttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32823078 |
gaagtgcggcgtagattctattccagaatttgcactgctcggggacattcacaaacctcgtagcttccatcacctctcgagagtacttcttcttctt--- |
32822982 |
T |
|
| Q |
101 |
ctccctctcactctcatcgctgtttgcggctgcaacaagctcctcagtgacagctaaaggaagggtgttcttgtgaatcttcttggaagcccttctattt |
200 |
Q |
| |
|
| ||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822981 |
ccccctctcactctcatcgctgttttccgctgcaacaagctcctcagtgacagttaaaggaagggtgttcttgtgaatcttcttggaagcccttctattt |
32822882 |
T |
|
| Q |
201 |
gattgttttcggttcacgggaaagctattgagcaaaat |
238 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
32822881 |
gattgttttcggttcacaggaaagctatcgagcaaaat |
32822844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 52721766 - 52721673
Alignment:
| Q |
1 |
gaagtgcggcgtagattctattccagaacttgcactgctcggggacattcacaaacctcgtagcttccatcatctctcgagagtacttcttctt |
94 |
Q |
| |
|
|||| |||| ||||||| | |||||||| ||| ||||| | |||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
52721766 |
gaagcgcggtgtagattgttttccagaatttgagctgctgagagacattcacaaacctcatagactccatcatctctcgagagtacttcttctt |
52721673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University