View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18038_low_19 (Length: 254)
Name: NF18038_low_19
Description: NF18038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18038_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 18633147 - 18632910
Alignment:
| Q |
10 |
catcatcactaaatgttttgtttcagatatattgcatgatttggattatcataggtataatattatggtatggtttatgttgcaaagctagtgtaaattt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18633147 |
catcaccactaaatgttttgtttcagatatattgcatgatttggattatcataggtataatattatggtatggtttatgttgcaaagttagtgtaaattt |
18633048 |
T |
|
| Q |
110 |
tgatctaattagtgcataatattatcataggttatattttgacgcgtatcaataatgtggtttgatttgtgtagcaagatcagtgtaaaattgcaaataa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18633047 |
tgatctaattagtgcataatattatcataggttatattttgatgcgtatcaataatgtggtttgatttgtgttgcaagatcagtgtaaaattgcaaataa |
18632948 |
T |
|
| Q |
210 |
atgtgctttttatacaaacaggtatggtctctgtgttg |
247 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18632947 |
atgtgctttttatacaaataggtatggtctctgtgttg |
18632910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 28975505 - 28975430
Alignment:
| Q |
16 |
cactaaatgttttgtttcagatatattgcatgatttggattatcataggtataatattatggtatggtttatgttg |
91 |
Q |
| |
|
|||||||| |||||||| |||| ||||| |||||||||||||||| ||||||||||||||| || ||| ||||| |
|
|
| T |
28975505 |
cactaaatattttgttttgaatattttgcacgatttggattatcatatgtataatattatggtttgatttgtgttg |
28975430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 35 - 151
Target Start/End: Original strand, 33270454 - 33270570
Alignment:
| Q |
35 |
gatatattgcatgatttggattatcataggtataata-ttatggtatggtttatgttgcaaagctagtgtaaattttgatctaattagtgcataatatta |
133 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||| ||| ||||||| || ||| ||||||||| | ||||||||||||| |||||| || | ||||||| |
|
|
| T |
33270454 |
gatattttgcaagatttggattatcatatgtatgatatttatggtttgatttgtgttgcaaaatcaatgtaaattttgatttaattaatg-aaaatatta |
33270552 |
T |
|
| Q |
134 |
tcataggttatattttga |
151 |
Q |
| |
|
||||| |||| |||||| |
|
|
| T |
33270553 |
tcataccttatgttttga |
33270570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University