View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_high_11 (Length: 308)
Name: NF1803_high_11
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 142 - 304
Target Start/End: Complemental strand, 35451350 - 35451189
Alignment:
| Q |
142 |
tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccattttaaagga |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35451350 |
tgttaggcttaagtttgttggggctttcttatacactgtactatatacaacgaccacaacaaaacggtatcagccgtagtgccgttaccgttttaaagga |
35451251 |
T |
 |
| Q |
242 |
attaatgnnnnnnnntaatcacaaactcaattgagctatgggttaaaagagttggaggttttg |
304 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35451250 |
attaatgaaaaaaaa-aatcacaaactcaattgatttatgggttaaaagagttggaggttttg |
35451189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University