View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_high_28 (Length: 205)
Name: NF1803_high_28
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_high_28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 28521216 - 28521420
Alignment:
| Q |
1 |
gctagctccatttactgctacattctcatctagaggaccaaatccaggatccaaacatcttctcaaggtattactattgatggtatttttccataaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521216 |
gctagctccatttactgctacattctcatctagaggaccaaatccaggatccaaacatcttctcaaggtattactattgatggtatttttccataaagaa |
28521315 |
T |
 |
| Q |
101 |
tgtatttaatgaactgaaggtgttttaaaatgtatatgatgcagcctgacattgcagctccaggcattgacatcttggcatcttatactcttaggaaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521316 |
tgtatttaatgaactgaaggtgttttataatgtatatgatgcagcctgacattgcagctccaggcattgacatcttggcatcttatactcttaggaaatc |
28521415 |
T |
 |
| Q |
201 |
actca |
205 |
Q |
| |
|
||||| |
|
|
| T |
28521416 |
actca |
28521420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University