View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_low_16 (Length: 301)
Name: NF1803_low_16
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 10442252 - 10442521
Alignment:
| Q |
19 |
caggttatatacatattcaaattatctacttattaatgaatttaatgtttgttttaaatctttgaatcacacannnnnnnn----------cagtcacaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10442252 |
caggttatatacatattcaaattatctacttattaatgaatttaatgtttgttttaaatctttgaatcacacactttatttttttttttttcagtcacaa |
10442351 |
T |
|
| Q |
109 |
tattctggggtgctaagttcttcggtggccccagtttgcaggagaagtttgacagaatcaattcaaaggcaagatagtcctgctaattcaagcaaagccc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10442352 |
tattctggggtgctaagttcttcggtggccccagtttgcaggagaagtttgacggaatcaattcaaaggcaagatagtcctgctaattcaagcaaagccc |
10442451 |
T |
|
| Q |
209 |
tacatcagtctgaaactgagatg-acacctatgccttattctgtgtctgtgactactgatgcatctaacacaccttcat |
286 |
Q |
| |
|
||| ||| || | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10442452 |
tac------ctg---ttgggtggcacacctatgccttattctgtgtctgtgactactgatgcatctaacacaccttcat |
10442521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University