View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_low_17 (Length: 294)
Name: NF1803_low_17
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 5745870 - 5746148
Alignment:
| Q |
1 |
aatgatgtaatccagatatgaagtatttgaggggtccatagcttcttgttcttcatttgaatattggagtttagcttggggtcataggtgtctgttcgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5745870 |
aatgatgtaatccagatatgaagtatttgaggggtccatagcttcttgttcttcatttgaatattggagtttagcttggggtcataggtgtctgttcgcg |
5745969 |
T |
|
| Q |
101 |
tttgctgtgaggattgctctgctctagtttcattaataattaacaatactactttctcccttattttgataggaactattcttatgcaagtatatgatgg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5745970 |
tttgctgcgaggattgctctgctctagtttcattaataattaacaatactactttctcccttattttgataggaactattcttatgcaagtatatgatgg |
5746069 |
T |
|
| Q |
201 |
tttgttgggnnnnnnnaagtttcagtgtcaggagtctagtgtttggtcgccctcaatcagcttgttccatggttgaaaa |
279 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5746070 |
tttgttgggtttttttaagtttcagtgtcaggagtctagtgtttggtcgccctcaatcagcttgttccatggttgaaaa |
5746148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University