View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_low_23 (Length: 246)
Name: NF1803_low_23
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 26768325 - 26768544
Alignment:
| Q |
21 |
ttgagaatagtgccaaaacatcacaaaggttacaagagacagcacatggaaaatggtatgtagaagtactcatatcatgctttgtgttcgtacatttgct |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26768325 |
ttgaaaatagtgccaaaacatcacaaaggttacaagagacagcacatggaaaatggtatgtagaagtactcatatcatgctttgtgttcgtacatttgct |
26768424 |
T |
|
| Q |
121 |
taaaggatcactctttaattaaccacacaaagaaaagtttgagacaagtttggaaatatgtggtgatatatttatatgctttgacacctatagtttcaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26768425 |
taaaggatcactctttaattaaccacacaaagaaaagtttgagacaagtttggaaatatgtggtgatatatgtatatgctttgacacctatagtttcaat |
26768524 |
T |
|
| Q |
221 |
gagactgtctattttcttgg |
240 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
26768525 |
gagactgtctattttgttgg |
26768544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University