View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_low_28 (Length: 226)
Name: NF1803_low_28
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 26767985 - 26768094
Alignment:
| Q |
107 |
aactataattgtaattgtgatattgtttctcatttgagattaatctccacaacggcatcgcgaccgcaatgcaattggtggagcaaccatagtttaaatc |
206 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||| | |||||||| |
|
|
| T |
26767985 |
aactataattgtaattatgatattgtttctcatttgagattaatctccacaacggcatcgcgaccgcaatgcaatcggtgaaacaaccaaaatttaaatc |
26768084 |
T |
 |
| Q |
207 |
tttctcatca |
216 |
Q |
| |
|
|||| ||||| |
|
|
| T |
26768085 |
tttcacatca |
26768094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 165
Target Start/End: Original strand, 26767863 - 26767930
Alignment:
| Q |
94 |
aattgtagtcagcaactataattgtaattgtgatattgtttctcatttgagattaatctccacaacggcatc |
165 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
26767863 |
aattgtagtcggtgactataattgtaattgtggtatt----ctcatttgagatcaatctccacaacggcatc |
26767930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University