View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1803_low_30 (Length: 213)
Name: NF1803_low_30
Description: NF1803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1803_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 1053815 - 1053634
Alignment:
| Q |
18 |
gattgtttagaaagtacacttgtgtagacctaagattccacactctaccatgtgccttctaagccatgtagttatggtctctaaattaaaagtatattaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1053815 |
gattgtttagaaagtacacttgtgtagacctaagattccacattctaccatgtgccttctaagccatgtagttatggtctctaaattaaaagtatattaa |
1053716 |
T |
 |
| Q |
118 |
ttactctctttctatcaatataattaacaggatagtcattttggatgtaattcatgtttggttaattgggagattatttcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1053715 |
ttactctctttctatcaatataattaatagtatagtcattttggatgtaattcatgtttggttaattgggagattatttcat |
1053634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University