View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18040_low_13 (Length: 397)
Name: NF18040_low_13
Description: NF18040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18040_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 112 - 382
Target Start/End: Original strand, 30741505 - 30741775
Alignment:
| Q |
112 |
accgttctgccacggtggttctgacggtggagccgttaaacaggagctttggtgtgtggcaaagaacaacgcggaggatgcagctttacagacagctcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30741505 |
accgttctgccacggtggttctgacggtggagccgttaaacaggagctttggtgtgtggcaaagaacaacgcggaggatgcagctttacagacagctcta |
30741604 |
T |
 |
| Q |
212 |
gactgggcttgtggagctggtggagctgattgtggcccaatccaaaacggaggaccttgctatgatgttaacagtgttcagaatactgcttcttatgctt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30741605 |
gactgggcttgtggagctggtggagctgattgtggcccaatccaaaacggaggaccttgctatgatgttaacagtgttcagaatactgcttcttatgctt |
30741704 |
T |
 |
| Q |
312 |
tcaatgattattttctcaaacatggtttgactgatgatagctgtagtttcaataacaatgctgctgttact |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30741705 |
tcaatgattattttctcaaacatggtttgactgatgatagctgtagtttcaataacaatgctgctgttact |
30741775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 30741424 - 30741477
Alignment:
| Q |
22 |
tcgtaacagtcacatttccaaaatgcccacaacaaaaagcttcgttttttcgga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30741424 |
tcgtaacagtcacatttccaaaatgcccacaataaaaagcttcgttttttcgga |
30741477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University