View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18040_low_23 (Length: 287)
Name: NF18040_low_23
Description: NF18040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18040_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 122 - 278
Target Start/End: Complemental strand, 54229082 - 54228927
Alignment:
| Q |
122 |
gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcattt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229082 |
gcaggggagctcctagtcaatctctctctggaactttatcttcatcaattgctaatttaacaaatcttaaacaagtgttagtcacatcttcctctcattt |
54228983 |
T |
 |
| Q |
222 |
gtcctttcccaatttcccccnnnnnnnnnnattaatatttcttacaatgtttcttct |
278 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54228982 |
gtcctttcccaatttccccc-tttttttttattaatatttcttacaatgtttcttct |
54228927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 54229193 - 54229160
Alignment:
| Q |
8 |
ctcttctgattcctttgttattggcttgtaacta |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54229193 |
ctcttctgattcctttgttattggcttgtaacta |
54229160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University