View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18040_low_36 (Length: 215)
Name: NF18040_low_36
Description: NF18040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18040_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 174
Target Start/End: Original strand, 24538070 - 24538229
Alignment:
| Q |
15 |
caaagggtagattgtgaagatcctgatataggttgtggaaaaatagtaaaatggtttatataacaaaataataaacctttttggaattcaagaaattgtc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24538070 |
caaagggtagattgtgaagatcctgatataggttgtggaaaaatagtaaaatggtttatctaacaaaataataaacctttttggaattcaagaaattgtc |
24538169 |
T |
|
| Q |
115 |
tatgcaataaaggtttatataagtttgtattttcttttaattgtttctagttgggtcttt |
174 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24538170 |
tatgcaataaaggtttatattattttgtatttccttttaattgtttctagttgggtcttt |
24538229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 24538246 - 24538283
Alignment:
| Q |
137 |
gtttgtattttcttttaattgtttctagttgggtcttt |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24538246 |
gtttgtattttcttttaattgtttttagttgggtcttt |
24538283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 136 - 187
Target Start/End: Complemental strand, 47431355 - 47431304
Alignment:
| Q |
136 |
agtttgtattttcttttaattgtttctagttgggtcttttagttgagtcttt |
187 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
47431355 |
agtttgtatttccttttaattgtttctagctgggccttttagttgggtcttt |
47431304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 196
Target Start/End: Original strand, 47431144 - 47431209
Alignment:
| Q |
131 |
atataagtttgtattttcttttaattgtttctagttgggtcttttagttgagtctttggtctttag |
196 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| | ||||||||| |||||| |||||||| |
|
|
| T |
47431144 |
atattagtttgtatttccttttaattgtttctagttaagctttttagttgggtctttagtctttag |
47431209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University