View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18042_low_27 (Length: 226)
Name: NF18042_low_27
Description: NF18042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18042_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 251602 - 251379
Alignment:
| Q |
1 |
aattctcattgttgtttgtatactctgacacaaaacaaatggttttataaagttgcatacacattgcatcatctcaaagtaaactttgtcataagtcatt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
251602 |
aattctcattgttgtttgtttactctgacacaa--caaatagttttataaagttgcatacacattgcatcatctcaaagtaaactttattataagtcatt |
251505 |
T |
 |
| Q |
101 |
gtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcactcaatgtcaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251504 |
gtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcactcaatgtcaaaac |
251405 |
T |
 |
| Q |
201 |
actcaccctacaatattaacaatctt |
226 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
251404 |
actcaccctacaacattaacaatctt |
251379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University