View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18043_high_8 (Length: 318)
Name: NF18043_high_8
Description: NF18043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18043_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 3 - 307
Target Start/End: Complemental strand, 42946038 - 42945737
Alignment:
| Q |
3 |
aagccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaaaacatcaca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42946038 |
aagccttaccttcttttctgtcacaaaatttgagtctctcatttagtgctctcaatttagaagaaacattccaactattcatgttggaaaa--catcaca |
42945941 |
T |
|
| Q |
103 |
agcaaggtaaaacagtacttcaaaaacattttgaaccttccttgtcatgttttcttcatagtttttctgcttctataacaaagtggtttgagttgagaac |
202 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
42945940 |
agcaaggtaaaacagtacatcaaaatcattttgaaccttccttgtcatgttttcttcatagtttttgtgcttctataacaaagtggtt-gagttgagaac |
42945842 |
T |
|
| Q |
203 |
ttttccgatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42945841 |
ttttccgatctcaagttcgctgcaccgcttttctaaggtattgtctactttggatcaaaaccattgaatctacaatggctctccgtcaacgcctccaccg |
42945742 |
T |
|
| Q |
303 |
ccttt |
307 |
Q |
| |
|
||||| |
|
|
| T |
42945741 |
ccttt |
42945737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University