View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18045_high_4 (Length: 367)
Name: NF18045_high_4
Description: NF18045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18045_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 6 - 353
Target Start/End: Original strand, 32845778 - 32846122
Alignment:
| Q |
6 |
ttctctatgaaaatatctaatattgttcccagcactgctgcaaaccacaaacagatccaatttttcgctcatatcagaaacagatgaaataatctgttaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845778 |
ttctctatgaaaatatctaatattgttcccagcactgc---aaaccacaaacagatccaatttttcgctcatatcagaaacagatgaaataatctgttaa |
32845874 |
T |
 |
| Q |
106 |
tctcttttgtatgttccccaaatcaaaaaccatacagtgagttgagaaacttcatactcaaaatctcaaatcaaaaaccctgattaatcagtggttacct |
205 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32845875 |
tcttttttgtatgttccccaaatcaaaaaccatacagtgagttgagaaacttcatactcaaaatctcaaatcaaaaaccctaattaatcagtggttacct |
32845974 |
T |
 |
| Q |
206 |
gaaagggatggtggtggaagatctggaggttgcagttgtaagttgtgttcttttttaagttcatttgaaattaagaaatatttgcactgtaacaccttta |
305 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845975 |
gaaagggatggtggtggcagatctggaggttgcagttgtaagttgtgttcttttttaagttcatttgaaattaagaaatatttgcactgtaacaccttta |
32846074 |
T |
 |
| Q |
306 |
tttttaccattgatttcattcagactttgttctaaattagtttaacat |
353 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32846075 |
tttttaccattgatttcactcagactttgttctaaattagtttaacat |
32846122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University