View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18045_low_11 (Length: 228)
Name: NF18045_low_11
Description: NF18045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18045_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 110 - 217
Target Start/End: Original strand, 11202184 - 11202291
Alignment:
| Q |
110 |
ccctaatcatgcccgcaatgaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgtagagtagccgccgacgagga |
209 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11202184 |
ccctaatcatgcccgctaagaacaaccgcaagaagaattcacgcgacccatttttcgacgacggtcccaccaaacgccgcagagtagccgccgacgagga |
11202283 |
T |
|
| Q |
210 |
tcatgatg |
217 |
Q |
| |
|
||| |||| |
|
|
| T |
11202284 |
tcaagatg |
11202291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 4 - 60
Target Start/End: Original strand, 11202079 - 11202134
Alignment:
| Q |
4 |
cataaacccactcatttctgaaacttaaaccctagcagcaacctttgtctttgtctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11202079 |
cataaacccactcatttctgaaacttaaaccctagcagcaacctttgt-tttgtctc |
11202134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University