View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18046_low_10 (Length: 254)
Name: NF18046_low_10
Description: NF18046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18046_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 31301500 - 31301279
Alignment:
| Q |
19 |
tcaagttcgaaacaccccaagaaaaaacaacttgactgcctacagaccagcatgcgcacaccagtccctgcagaacaaaaaacctgcatcaatacaacag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||| |
|
|
| T |
31301500 |
tcaagttcgaaacaccccaagaaaaaacaacctgactgcctacagaccagcatgcgcacaccagtccctgcataacaaaaaacctgcagcaatacagcag |
31301401 |
T |
|
| Q |
119 |
ttgcataacagaagcagaaacaggccaggcaccccaacaactgcggtttaacagcaccacctgaaacaacactaaccagcacacatagcagccgcaaaaa |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31301400 |
gagcataacagaagcagaaagaggccaggcaccccaacagctgcggtttaacagcaccaccagaaacaacactaaccagcacacacagcagccgcaaaaa |
31301301 |
T |
|
| Q |
219 |
cactacctccttcctatccttt |
240 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
31301300 |
cactacctccttcctacccttt |
31301279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University