View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18046_low_4 (Length: 330)
Name: NF18046_low_4
Description: NF18046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18046_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 232
Target Start/End: Original strand, 19597012 - 19597232
Alignment:
| Q |
12 |
gcaaaggctatgaagatttcaactggatcaatgatctgcatattatgttgttcattagattgtgatgctcttcgtaatggtgatgatggtggtgatactg |
111 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597012 |
gcaaagactatgaagatttcaattggatcaatgatctgcatattatcttgttcattagattgcgatgctcttcgtaatggtgatgatggtggtgatactg |
19597111 |
T |
|
| Q |
112 |
ttggtgatggtgttgatggtcgtcctagtgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggaggacgaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597112 |
ttggtgatggtgttgatggtcgtcctgatgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggaggacgaat |
19597211 |
T |
|
| Q |
212 |
gtgactcgatgaaaaattaga |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19597212 |
gtgactcgatgaaaaattaga |
19597232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 85 - 131
Target Start/End: Original strand, 19597241 - 19597287
Alignment:
| Q |
85 |
gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597241 |
gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt |
19597287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University