View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_high_12 (Length: 363)
Name: NF18047_high_12
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 44381169 - 44381522
Alignment:
| Q |
1 |
tttcacctccgatggagattctgacgctgttggcgtcagtaactgggattgttgttctgtttcgctatgttctcgggttaccggaattcgggttgatacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44381169 |
tttcacctccgatggagattctgacgctgttggcgtcagtaactgggattgttgttctgtttcgctatgttctcgggttactggaattcgggttgatacg |
44381268 |
T |
 |
| Q |
101 |
atggaggggttttgcaggattcttgctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtatacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381269 |
atggaggggttttgcaggattcttgctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtatacc |
44381368 |
T |
 |
| Q |
201 |
ttttcaggaaggttgatgtgaaccgggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381369 |
ttttcaggaaggttgatgtgaaccgggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattt |
44381468 |
T |
 |
| Q |
301 |
tgaaaatgctcctttgaggattttgcagtatattttgttgatgactgatgatgt |
354 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381469 |
tgaaaatgctcctttgaagattttgcagtatattttgttgatgactgatgatgt |
44381522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University