View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_high_17 (Length: 326)
Name: NF18047_high_17
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 41 - 318
Target Start/End: Complemental strand, 22305986 - 22305709
Alignment:
| Q |
41 |
tggtggtggtcaatggtgtgctgcaagggaatcagctgcagagactactttaaaggtagctttggattatgcttgtggatatggtgcagattgttcacaa |
140 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22305986 |
tggtggtggtcaatggtgtgttgcaagtgaatcagctgcagagactactttaaaggtagctttggattatgcctgtggatatggtgcagattgttcacaa |
22305887 |
T |
 |
| Q |
141 |
cttcaacaaggtggagcttgttatgatccaaatactttgaaagatcatgcttcttatgcattcaatgattactatcaaaagaatcctgcacctacaagtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22305886 |
cttcaacaaggtggagcttgttatgacccaaatactttgaaagatcatgcttcttatgcattcaatgattactatcaaaagaatcctgcacctacaagtt |
22305787 |
T |
 |
| Q |
241 |
gtgtatttggaggagtagcatcactcacaagcaaagatccaagtaagatattcatacaacattgaagtaacctatgat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22305786 |
gtgtatttggaggagtagcatcactcacaagcaaagatccaagtaagatattcatacaacattgaagtaacttatgat |
22305709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 50
Target Start/End: Complemental strand, 22306039 - 22305992
Alignment:
| Q |
3 |
ccaactgtgattcctacaactccaggaacaggatcatctggtggtggt |
50 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22306039 |
ccaactgtgactcctacaacaccaggaacaggatcatctggtggtggt |
22305992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 217
Target Start/End: Original strand, 55946395 - 55946445
Alignment:
| Q |
167 |
tccaaatactttgaaagatcatgcttcttatgcattcaatgattactatca |
217 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
55946395 |
tccaaatactgtgaaggatcatgcttcctatgccttcaacgattactatca |
55946445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University