View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_high_25 (Length: 250)
Name: NF18047_high_25
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 9 - 153
Target Start/End: Complemental strand, 8491432 - 8491288
Alignment:
| Q |
9 |
gattatactgcaggttttcagatgacttttcctgcggattttcagtgttagttaattgccttataaacaaaagaaacaatttgagctgtttttgtgtgta |
108 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8491432 |
gattttactgcaggttttcagatgacctttcctgcggattttcagtgttacttaattgccttataaacaaaacaaacaatttgagctgttttcgtgtgta |
8491333 |
T |
 |
| Q |
109 |
tggtcttgaaatgtgacttatattttattgactcacaaatgtgtc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8491332 |
tggtcttgaaatgtgacttatattttattgacacacaaatgtgtc |
8491288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 222 - 250
Target Start/End: Complemental strand, 8491219 - 8491191
Alignment:
| Q |
222 |
caggagtgggaaggaagaacaaatattgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8491219 |
caggagtgggaaggaagaacaaatattgc |
8491191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University