View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_high_9 (Length: 398)
Name: NF18047_high_9
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_high_9 |
 | |
|
| [»] scaffold0076 (1 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 5e-72; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 215 - 379
Target Start/End: Original strand, 33704510 - 33704681
Alignment:
| Q |
215 |
ggatccgtccctgactctgtctacaatgcccacatggc-------gtagttatccatgtgtgcgtctctcttactcacgtgaacgtttatacagaaattt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33704510 |
ggatccgtccctgactctgtctacaatgcccacatggcactccccgtagttatccatgtgtgcgtctctcttactcacgtgaacgtttatacagaaattt |
33704609 |
T |
|
| Q |
308 |
gattaaaaggactagcttattgtaacggtagtaacatacgagatcaacataaaaggtggagatcccgtaaat |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
33704610 |
gattaaaaggactagcttattgtaacggtagtaacataagtgatcaacataaaaggtggagatcccgtaaat |
33704681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Original strand, 21137494 - 21137537
Alignment:
| Q |
151 |
tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc |
194 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
21137494 |
tcatacgcaattgtgaaggtaatttcatggctgtcttttccttc |
21137537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Original strand, 33715329 - 33715372
Alignment:
| Q |
151 |
tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
33715329 |
tcatacgcggtagtgaaggtaatttcaaggctgtcttttccttc |
33715372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 194
Target Start/End: Original strand, 21313170 - 21313202
Alignment:
| Q |
162 |
agtgaaggtaatttcaaggctttcttttccttc |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
21313170 |
agtgaaggtaatttcaaggctgtcttttccttc |
21313202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 254 - 357
Target Start/End: Original strand, 18622 - 18726
Alignment:
| Q |
254 |
tagttatccatgtgtgcgtctctcttactcacgtgaacgttt-atacagaaatttgattaaaaggactagcttattgtaacggtagtaacatacgagatc |
352 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
18622 |
tagttatccatgcgtgcgtctctcgtagtcacgtgaacgttttatacagaaatttgattaaaaggactagcttattgtaaaggtagtaacataagagatc |
18721 |
T |
|
| Q |
353 |
aacat |
357 |
Q |
| |
|
||||| |
|
|
| T |
18722 |
aacat |
18726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 140
Target Start/End: Complemental strand, 46913 - 46837
Alignment:
| Q |
62 |
ctgcttgtgtctctggcaagataaagccaccagcagattttgtgactcttatctgtgatggcacgtggcgatcgacaga |
140 |
Q |
| |
|
||||||| |||||||||| ||||||| | ||||||||||||||| ||||||||| |||||| | |||||||||||||| |
|
|
| T |
46913 |
ctgcttgcgtctctggca-gataaagtctccagcagattttgtggctcttatctatgatgg-gcatggcgatcgacaga |
46837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 46814 - 46771
Alignment:
| Q |
151 |
tcatacgcaatagtgaaggtaatttcaaggctttcttttccttc |
194 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
46814 |
tcatacgcagtagtgaagttaatttcaaggctgtcttttccttc |
46771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University