View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_low_25 (Length: 257)
Name: NF18047_low_25
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 35 - 208
Target Start/End: Original strand, 20897998 - 20898171
Alignment:
| Q |
35 |
agaacctgtgttcgaatcctgaataaaacattagtagcacaaatgtttacaagtcttgttcgtgctattctaaaagatttttagcttaaaatctcaaaat |
134 |
Q |
| |
|
||||||| |||||||||||||||||||||| || |||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20897998 |
agaacctatgttcgaatcctgaataaaacaataatagcacaaatgtttactagtcttgttcgggctattctgaaagatttttagcttaaaatctcaaaat |
20898097 |
T |
 |
| Q |
135 |
tttgtctttttgacgaaggctggtatgaaagcaaatacaatgaaagattttgcagctttaacaggaggttcttc |
208 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
20898098 |
tttgtctttttgactagggctggtatgaaagcaaattcaatgaaaaattttgcagcttcaacagaaggttcttc |
20898171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University