View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18047_low_27 (Length: 250)

Name: NF18047_low_27
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18047_low_27
NF18047_low_27
[»] chr6 (2 HSPs)
chr6 (9-153)||(8491288-8491432)
chr6 (222-250)||(8491191-8491219)


Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 9 - 153
Target Start/End: Complemental strand, 8491432 - 8491288
Alignment:
9 gattatactgcaggttttcagatgacttttcctgcggattttcagtgttagttaattgccttataaacaaaagaaacaatttgagctgtttttgtgtgta 108  Q
    |||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||    
8491432 gattttactgcaggttttcagatgacctttcctgcggattttcagtgttacttaattgccttataaacaaaacaaacaatttgagctgttttcgtgtgta 8491333  T
109 tggtcttgaaatgtgacttatattttattgactcacaaatgtgtc 153  Q
    |||||||||||||||||||||||||||||||| ||||||||||||    
8491332 tggtcttgaaatgtgacttatattttattgacacacaaatgtgtc 8491288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 222 - 250
Target Start/End: Complemental strand, 8491219 - 8491191
Alignment:
222 caggagtgggaaggaagaacaaatattgc 250  Q
    |||||||||||||||||||||||||||||    
8491219 caggagtgggaaggaagaacaaatattgc 8491191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University