View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18047_low_28 (Length: 245)
Name: NF18047_low_28
Description: NF18047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18047_low_28 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 4835 - 5057
Alignment:
| Q |
1 |
aaccaatataatagattaattaattgcatttttgtcacactattannnnnnnggacaaatgtaagtggttaatctgttagagcnnnnnnnnnnnnnttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4835 |
aaccaatataatagattaattaattgcatttttgtcacactatt-ttattttggacaaatgtgagtggttaatctgttagagcgagagagag----ttta |
4929 |
T |
 |
| Q |
101 |
ttagcagaagagattgaactctgaaccttcttcttaatacaacttcgtcgtgccaacccgtattagcgggctacaccttcggacacacattttgtcacac |
200 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
4930 |
ttagcaccagagattgaaccctaaaccttcttcttaatacaacttcgtcgtgccaacccgtattagcgggctacaccttcagacacacattttttcacac |
5029 |
T |
 |
| Q |
201 |
acttaaactttgattaggtagtgatcta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5030 |
acttaaactttgattaggtagtgatcta |
5057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University