View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18048_high_1_N (Length: 468)
Name: NF18048_high_1_N
Description: NF18048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18048_high_1_N |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 206 - 455
Target Start/End: Complemental strand, 6486616 - 6486367
Alignment:
| Q |
206 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgaacatggtgcagttcgctgcagaaccatttgatgtaaactgaatttgagtt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6486616 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgtacatggtgcagttcgctgcagaaccgtttgatgtaaactgaatttgagtt |
6486517 |
T |
|
| Q |
306 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486516 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
6486417 |
T |
|
| Q |
406 |
tgaaatttggaattcagattaagtggtgagggctcaccaatgatgatgtc |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486416 |
tgaaatttggaattcagattaagtggtgagggctcaccaatgatgatgtc |
6486367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 28 - 145
Target Start/End: Complemental strand, 6486795 - 6486678
Alignment:
| Q |
28 |
caatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcagcagcgccgcctcccccatgagcccttactactacg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486795 |
caatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatgcgtagcagcagcgccgcctcccccatgagcccttactactacg |
6486696 |
T |
|
| Q |
128 |
accctggaaggtctctcc |
145 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6486695 |
accctggaaggtctctcc |
6486678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University