View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18049_high_8 (Length: 372)
Name: NF18049_high_8
Description: NF18049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18049_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 9 - 356
Target Start/End: Original strand, 35351453 - 35351796
Alignment:
| Q |
9 |
agcataggaaacaaccaaaccatgaaatgagcgaggaccaggactcaaaccagcagcaatcatatcatacataacttgagaaactccggttgagtcacgg |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351453 |
agcataggaaacaaccaaaccatgaaacgagcgaggaccaggactcaaaccagcagcaatcatatcatacataacttgagaaactccggttgagtcacgg |
35351552 |
T |
|
| Q |
109 |
ttcctagaccggttcatgagctcttccatgaaactgaaccggagactgttctcaagtaaagtgtcatcatctttcacttgcttcttctttctggttcgct |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351553 |
ttcctagcccggttcatgagctcttccatgaaactgaaccggagactgttctcaagtaaagtgtcatcatctttcacttgcttcttctttctggttcgct |
35351652 |
T |
|
| Q |
209 |
tctctggagaagatagcgctgctcgaactggtccggttcgaggagttaagcggtttaatttgaaggggatgtaagtggagccgtaactgtaacatgaatg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351653 |
tctctggagaagatagcgctgctcgaactggtccggttcgaggagttaagcggtttaatttgaaggggatgtaagtggagccgtaactgtaacatgaatg |
35351752 |
T |
|
| Q |
309 |
catgtgtaaagagttttggtttgagagttgagagagtgaagtggttat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35351753 |
catgtgtaaagagttttggtttgagagt----agagtgaagtggttat |
35351796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University