View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18049_low_19 (Length: 286)

Name: NF18049_low_19
Description: NF18049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18049_low_19
NF18049_low_19
[»] chr4 (1 HSPs)
chr4 (225-273)||(20458222-20458270)


Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 20458270 - 20458222
Alignment:
225 gaatgaaatgatcattgaggttagatgttgggtgttgatgaggattgtg 273  Q
    |||||| | |||| |||||||||||||||||||||||||||||||||||    
20458270 gaatgagacgatcgttgaggttagatgttgggtgttgatgaggattgtg 20458222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University