View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18049_low_19 (Length: 286)
Name: NF18049_low_19
Description: NF18049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18049_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 20458270 - 20458222
Alignment:
| Q |
225 |
gaatgaaatgatcattgaggttagatgttgggtgttgatgaggattgtg |
273 |
Q |
| |
|
|||||| | |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20458270 |
gaatgagacgatcgttgaggttagatgttgggtgttgatgaggattgtg |
20458222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University