View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18049_low_26 (Length: 230)
Name: NF18049_low_26
Description: NF18049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18049_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 28 - 175
Target Start/End: Complemental strand, 30856767 - 30856620
Alignment:
| Q |
28 |
ttaaatattaattaaatgtctaaacctattttactatttgtcacgtaatctttgtcgcacatgaattctccttccttagttgtgatcaataaattgattc |
127 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30856767 |
ttaaatgttaattaaatgtctaaacctattttactatttgtcacgtaatctttgtcgcacatgaattctccttccttagttgtgatcaataaattgattc |
30856668 |
T |
|
| Q |
128 |
attttctccctaaaaaataagattgaacccctcttgtaaacatcacac |
175 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30856667 |
attttctccctaaaaaataaaattgaacccctcttgtaaacatcacac |
30856620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 46
Target Start/End: Complemental strand, 30856792 - 30856760
Alignment:
| Q |
14 |
aatattgaagttatttaaatattaattaaatgt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30856792 |
aatattgaagttatttaaatattaattaaatgt |
30856760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University