View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_high_13 (Length: 356)
Name: NF1804_high_13
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 48451803 - 48452134
Alignment:
| Q |
18 |
taaggcataccagggtgattgtggtgctgtgggtggatctgatgccaagaagccccctgaatctcaatttgctgaagcttttgccccaaactgtggtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451803 |
taaggcataccagggtgattgtggtgctgtgggtggatctgatgccaagaagccccctgaatctcaatttgctgaagcttttgccccaaactgtggtgtt |
48451902 |
T |
|
| Q |
118 |
aaggcatcaactcttgctcgtataactggtcgtttcttggggtgccagactaagtatgtccatgcacctgaggcgttttctgaaatcctgataagaaacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451903 |
aaggcatcaactcttgctcgtataactggtcgtttcttggggtgccagactaagtatgtccatgcacctgaggcgttttctgaaatcctgataagaaacg |
48452002 |
T |
|
| Q |
218 |
agaagagcttagacatactctacagtaagaatcacactcaggtcggtgctgctgtaaccggtactgatagagggtctccttatttctggtgtgtgttgtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48452003 |
agaagagcttagacatactctacagtaagaatcacactcaggtcggtgctgctgtaaccggtactgatggagggtctccttatttctggtgtgtgttgtt |
48452102 |
T |
|
| Q |
318 |
tagcaatggcaaacctaacagtacctttgctt |
349 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
48452103 |
tagcaatggcaaacctaacagcacctttgctt |
48452134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University