View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_high_15 (Length: 332)
Name: NF1804_high_15
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 312
Target Start/End: Complemental strand, 35126721 - 35126432
Alignment:
| Q |
23 |
cacagaaaacccaaaagcaaccaactttaaatggcaaagtgaattgataacaacattaagaataaaagtatcaggctttatacctaaagaagaatgcatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35126721 |
cacagaaaacccaaaagcaaccaactttaaatggcaaagtgaattgataacaacattaagaataaaagtatcaggctttatacctaaagaagaatgcatt |
35126622 |
T |
 |
| Q |
123 |
tctttaactaaggatatagcagttgtgtaatgcttcatcttcacaataaaccctaataacaaagtaaagtctataacagaaggcaaagggttcattttag |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35126621 |
tctttaactaaagatatagcagttgtgtaatgcttcatcttcacaataaaccctaataacaaagtaaagtctataacagaaggcaaagggttcattttag |
35126522 |
T |
 |
| Q |
223 |
ccatggtatgnnnnnnntttaaagcttcatcaatgctcttcagtttacctgatttgcattggtttctcatgaaattcaggaactgggttt |
312 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35126521 |
ccatggtatgaaaaaaatttaaagcttcatcaatgctcttcagtttacctgatttgcattggtttctcatgaaattcagaaactgggttt |
35126432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University