View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_high_29 (Length: 263)
Name: NF1804_high_29
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 1104729 - 1104918
Alignment:
| Q |
19 |
gcttccacagtaggtaaatgtgttatggttctttaatgtttatttattt-ggttatatttgtgtctgtttttgctaatccctacataaatatttaggctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1104729 |
gcttccacagtaggtaaatgtgttatggttctttaatgtttatttatttaggttatatttgtgtctgtttttcctaatccctacataaatatttaggctg |
1104828 |
T |
|
| Q |
118 |
ccaacaaattttcatagaattaattcatatgacatctttgaaaatatgtttttcatccgaataaataatctaaattactttcattatttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1104829 |
ccaacaaattttcatagaattaattcatatgacatctttgaaataatgtttttcatccgaataaataatctaaattactttcattatttt |
1104918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University