View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1804_high_35 (Length: 229)

Name: NF1804_high_35
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1804_high_35
NF1804_high_35
[»] chr3 (1 HSPs)
chr3 (90-167)||(31536765-31536841)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 90 - 167
Target Start/End: Complemental strand, 31536841 - 31536765
Alignment:
90 cctctagacgaaactctgaattaaatattctcttcatttgacaaaacaacattaaatattacatttgatgaacttaag 167  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||    
31536841 cctctagacgaaattctgaattaaatattctcttcatttgacaaaacaacattaaatatta-attggacgaacttaag 31536765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University