View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_low_23 (Length: 287)
Name: NF1804_low_23
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 45667676 - 45667406
Alignment:
| Q |
1 |
ataatagttgctaggccacccgcggaacatccggaaagaagagcttgatttgcaaaatgcattccctttgacatcaaatcttccattgcagctgcccaaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45667676 |
ataatagttgctaggccaccagcggaacatccggaaagaagagcttgattagcaaaatgcattccctttgatatcaaatcttccattgcagctgcccaaa |
45667577 |
T |
 |
| Q |
101 |
tacgctgtcctctaaattgcagttctgcatcctatcttaccagacaacatatgcaaataaagtagtaaatactcatttcatcacatgaatgaatgtcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667576 |
tacgctgtcctctaaattgcagttctgcatcctatcttaccagacaacatatgcaaataaagtagtaaatactcatttcatcacatgaatgaatgtcaag |
45667477 |
T |
 |
| Q |
201 |
taagttcaagtcgtgtatctcaacaacggtgttattttttctcttttataccttactctgacaagtttctg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667476 |
taagttcaagtcgtgtatctcaacaacggtgttattttttctcttttataccttactctgacaagtttctg |
45667406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 52 - 121
Target Start/End: Original strand, 37972757 - 37972826
Alignment:
| Q |
52 |
gcaaaatgcattccctttgacatcaaatcttccattgcagctgcccaaatacgctgtcctctaaattgca |
121 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||| |||||| |||||| ||||||||||| ||||||| |
|
|
| T |
37972757 |
gcaaaacgcattccttttgacatcaaatcctccactgcagccaaccaaatgcgctgtcctctgaattgca |
37972826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University