View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_low_24 (Length: 278)
Name: NF1804_low_24
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 48 - 260
Target Start/End: Original strand, 34891373 - 34891585
Alignment:
| Q |
48 |
cctaaattcataatagaagtatcagaagcaaaatcattaacccaatcaacaaacctaaccctaacccaactcctccccaccattgtcaaatcatcccaac |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891373 |
cctaaattcataatagaagtatcagaagcaaaatcattaacccaatcaacaaacctaaccctaacccaactcctccccaccattgtcaaatcatcccaac |
34891472 |
T |
|
| Q |
148 |
cattagcccgtgtccctatctccaaattccacgttgcggccgtcgcagttggaatctccggtcgaatcttcatcggtgtcaatgtcgaattccctaacct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891473 |
cattagcccgtgtccctatctccaaattccatgttgcggccgtcgcagttggaatctccggtcgaatcttcatcggtgtcaatgtcgaattccctaacct |
34891572 |
T |
|
| Q |
248 |
tccttttcaccat |
260 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34891573 |
tccttttcaccat |
34891585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University