View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_low_35 (Length: 243)
Name: NF1804_low_35
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 720617 - 720831
Alignment:
| Q |
17 |
gttgaaacttcaataataaaatagttggctttacatattgtttttgtactatgtattgggttgagttatctctttaattgttttcttttatatatgtata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
720617 |
gttgaaacttcaataataaaatagttggctttacatattgtttttgtactatgtaatgggttgagttatctctttaattgttttcttttatatatgtata |
720716 |
T |
 |
| Q |
117 |
atatagtggtgctttatttgctgttcaaaaattcgtgattacttgaagnnnnnnnntagtgattaggtgtaaattaaataataaatatattcactaatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
720717 |
atatagtggtgctttatttgctgttcaaaaattcgtgattacttgaagaaaaaaaatagtgattaggtttaaattaaat----aatatattcactaatat |
720812 |
T |
 |
| Q |
217 |
atggcagctgatcccattc |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
720813 |
atggcagctgatcccattc |
720831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University