View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_low_37 (Length: 229)
Name: NF1804_low_37
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 90 - 167
Target Start/End: Complemental strand, 31536841 - 31536765
Alignment:
| Q |
90 |
cctctagacgaaactctgaattaaatattctcttcatttgacaaaacaacattaaatattacatttgatgaacttaag |
167 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
31536841 |
cctctagacgaaattctgaattaaatattctcttcatttgacaaaacaacattaaatatta-attggacgaacttaag |
31536765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University