View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1804_low_38 (Length: 227)
Name: NF1804_low_38
Description: NF1804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1804_low_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 80 - 227
Target Start/End: Complemental strand, 26609798 - 26609652
Alignment:
| Q |
80 |
tactgcacataaaattttgtgacttctattattttttattcgcataagaatatatgcaagatagaatataataatgagnnnnnnnnnnnnnnnngtgaac |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26609798 |
tactgcacataaaattttgtgacttctattattttt-attcgcataagaatatatgcaagatagaatataataatgagttttttagttttttttgtgaac |
26609700 |
T |
 |
| Q |
180 |
gatatcgataaaccagtcatgcacgtaaacggatatattctcgataat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609699 |
gatatcgataaaccagtcatgcacgtaaacggatatattctcgataat |
26609652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University